AJMB

Fluorescent Detection of Methicillin Resistant Staphylococcus aureus by Loop-mediated Isothermal Amplification Assisted with Streptavidin-coated Quantum Dots

PDF - Export to EndNote - PubMed Central XML format - PubMed Central XML format - PubMed Central XML format
PMID: 35509356 (PubMed) - PMCID: PMC9017464 - View online: PubReader
Volume 14, Issue 1, January-March , Page 79 to 88
Monday, June 28, 2021 :Received , Monday, October 18, 2021 :Accepted


  • - Research Center for Thalassemia, Mazandaran University of Medical Sciences, Sari, Iran
    - Department of Medical Microbiology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
  • Corresponding author Immunogenetics Research Center, Mazandaran University of Medical Sciences, Sari, Iran, Tel: +98 113 3543088; Fax: +98 113 3543087; E-mail: pooriagill@yahoo.com; p.gill@mazums.ac.ir

  • - Department of Medical Microbiology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
    - Research Center for Pediatric Infectious Diseases, Mazandaran University of Medical Sciences, Sari, Iran

  • - Immunogenetics Research Center, Department of Medical Nanotechnology, Faculty of Advanced Technologies in Medicine, Mazandaran University of Medical Sciences, Sari, Iran

Abstract:

Background: Methicillin Resistance Staphylococcus aureus (MRSA) could be considered as a major concern in medicine can cause nosocomial infection and bacteremia, especially in patients using catheter and household medical devices.

Methods: Using molecular diagnostic methods are important for identification of MRSA from the Methicillin Sensitive Staphylococcus aureus (MSSA). Here we described a fluorescent assay using biotin-labelling Loop-mediated isothermal amplification (LAMP) method assisted with streptavidin-coated Quantum Dots (QDs) for detection of MRSA. For comparison, another fluorescent assay using LAMP assisted with Green Viewer (GV; a fluorescent dye) was applied for detection of MRSA. The mecA gene was selected as the target for amplification by LAMP and for biotin-labeling of the LAMP amplicons, biotin-11-dUTP was mixed with the dNTPs (deoxy Nucleotide Phosphates) in LAMP reaction. For determining the clinical performance of the developed assay, 30 blood samples with MRSA positive results were tested with QD-LAMP, the conventional LAMP, GV-LAMP, and Polymerase Chain Reaction (PCR).

Results: Obtained results indicated that % sensitivity of QD-LAMP was 86.66% for detection of mecA positive MRSA samples; however, the Limit of Detection (LoD) of QD-LAMP was 1.5×104 Colony Forming Unit (CFU).

Conclusion: The results suggested that the QD-LAMP assay was easy to operate and could be used for detection of MRSA in parallel to the blood culture with less sensitivity for detection of bacteremia and pediatric septicemia with low counts of MRSA.


 

 

Introduction :

Staphylococcus aureus (S. aureus) including Methicillin Resistance S. aureus (MRSA) is responsible for a wide range of serious diseases such as skin infections osteomyelitis, endocarditis, pneumonia, toxic shock syndrome, scalded skin syndrome, and septicemia in humans 1,2. MRSA, considered as a major concern in medicine, can cause nosocomial infection and bacteremia, especially in patients using catheter and household medical devices worldwide. Furthermore, it plays an important role in development of Multidrug Resistant (MDR) 1,3.

The mecA gene is in charge of encoding an alternative Penicillin-Binding Protein, PBP 2a, and causing resistance to methicillin and all beta-lactam antibiotics by having low affinity to β-lactam ring 1,4. This gene along with its regulators are located on Staphylococcal Cassette Chromosome mec (SCCmec) 5.

Currently, S. aureus has commonly been diagnosed via routine standard procedures including colony morphology, Gram staining, differential tests (e.g. coagulase, catalase, DNase) and Polymerase Chain Reaction (PCR) 6,7. These methods are time consuming and expensive; therefore, the tests cannot be used in the urgent and crucial situation 6. In addition, PCR method has been restricted by many extra problems, such as requiring special equipment, PCR thermocycler and expert personnel, operating space, complicated sample preparation procedure, cross-reaction of primers, self-inhibition because of dimmers formation 8,9. So, promotion of amplification and detection methods for diagnosing these bacterial agents is needed.

In the last decade, Loop-mediated isothermal amplification (LAMP) has been considered as a novel nucleic acid amplification method 10-14, and used to detect various micro-organisms, such as Escherichia coli 15, Yersinia pseudotuberculosis 16, Salmonella 17, Vibrio parahaemolyticus 18,19, and MRSA 2,4,8,20,21. This method is based on an auto-cycling strand displacement DNA synthesis performed by the Bst DNA polymerase large fragment which is extracted from Bacillus stearothermophilus 4,7. The reaction happens under the isothermal conditions between 60-65°C in a single tube by a set of four to six specific designed primers i.e., Forward Inner Primer (FIP), Backward Inner Primer (BIP), Forward outer Primer (F3), Backward outer Primer (B3), Loop primer F (Loop-F) and Loop primer B (Loop-B) 22-24. A dumbbell shape DNA is produced which acts as a template for cycle amplification with several inverted repeats of the target sequence and multiple loops 7,14. The superiorities of LAMP method compared to other techniques are simplicity, rapidity, specificity and sensitivity 7,8,14. Indeed, because of the large number of DNA copies (to 109) produced in LAMP reaction, the product can be determined via simple methods such as colorimetry and photometry 21,24.

Quantum Dots (QDs) are one of the well-known fluorescent materials that have several photophysical properties including long life, stability, high quantum yield, high extinction coefficient, and small size; these properties make it superior to other fluorescent materials 25. QDs are excited with a wide range of wavelengths, but emulate only wavelengths at a specific wavelength 26. We hypothesized that the biotin-labeled LAMP amplicons can be detected with the streptavidin-coated QDs to diminish time of assay and result in increased sensitivity and raising limit of MRSA detection by isothermal LAMP method (Figure 1). To the best of our knowledge, there are no diagnostic studies regarding the usage of QD-LAMP in detection of MRSA. In the current study, a LAMP protocol has been developed, optimized, evaluated and applied to detect mecA gene of MRSA, requiring about 60 min for the whole process.

 

Materials and Methods :

Bacterial collection and culture: Thirty bacterial blood samples were obtained from positive cultures of MRSA at three hospitals. Then, we mixed one loop of colonized bacteria on trypticase soy agar with 10 ml normal saline. This dilution is equal to 1 McFarland, which read absorption at wavelength of 625 nm between 0.08 to 0.13 27,28. Subsequently, 500 µl of this dilution
with 1.5×1016 Colony Forming Unit (CFU) cell density was mixed with 500 µl blood containing Ethylene Diamine Tetra Acetic acid (EDTA). Final dilution was 0.5 McFarland with 1.5×108 CFU cell density that we utilized as bacterial sample in our study. The samples were confirmed by standard biochemical tests 29. In brief, all of them were cultured on blood and mannitol salt agars and incubated overnight at 37°C. Strains that showed 𝛽-hemolysis in blood agar and changed the color of culture medium to yellow were subjected to Coagulase test and Oxacillin disk diffusion test. The sample was confirmed as MRSA strain if it was positive in the Coagulase test and had zone diameter of less 22 mm in Oxacillin disk diffusion test 29.

Extraction of DNA template: DNA template from MRSA was obtained by QIAamp DNA mini kit produced by QIAgene Company (Germany). Briefly 20 μl proteinase K was pipetted into the 1.5 ml micro centrifuge tube. 200 μl blood sample was added to the micro centrifuge tube. Then 200 μl AL Buffer was added to the sample and mixed by pulse-vortexing for 15 s. For efficient lysis, the sample and Buffer AL were mixed completely to turn over a homogeneous solution. The tube was incubated at 56°C for 10 min. Afterward the tube was briefly centrifuged to remove drops from the inside of the lid. Next 200 μl ethanol (96-100%) was added to the tube, and mixed again by pulse-vortexing for 15 s.

Then the mixture was applied from previous step to the QIAamp mini spin column (in a 2 ml collection tube) and centrifuged at 6000×g for 1 min. The QIAamp mini spin column was placed in a clean 2 ml collection tube, and the tube containing the filtrate was removed. Next the QIAamp mini spin column was opened and add 500 μl buffer AW1 and centrifuged again at 6000×g for 1 min. The QIAamp mini spin column was put in a clean tube, and the tube containing the filtrate was removed. Afterward, 500 μl buffer AW2 was added and centrifuged at full speed (20,000×g) for 3 min. helping to remove buffer AW2 completely, the previous step was repeated. Again the QIAamp mini spin column was placed in a new 1.5 ml microcentrifuge tube and 200 μl buffer AE was added and Incubated at room temperature (15-25°C) for 1 min, then centrifuged at 6000×g for 1 min. DNA was filtrated from the column and placed in 1.5 ml tube 30.

Primer design of the mecA gene to LAMP assay: The mecA gene was selected for this study. Two pairs of primers, including F3 (5′- AGTTC TTTAGC GATTGCTTTA -3′), B3 (5′- TGGA AGTTAGATTGGGATCA -3′), FIP (5′- AATGTGGAATTGGCCAATACAGGATTTAGATACATTCTTTGGAACGATG-3′), and BIP (5′- CGGTCTAAAATTTTACCACGTTCTGCGTCATTATTCCAGGAATGCA-3′), were designed (Figure 2) according to the accession number NZ_ CP010300.1 (i.e., NCBI Reference Sequence) by using online Primer Explorer V4 program (Primer Explorer, Eiken Chemical Co., Japan). The LAMP primers for amplification were synthesized by Bioneer Co. Ltd. (South Korea).

Optimization of the biotin-labelling LAMP: Optimization of the biotin-labelling LAMP was performed on a reference MRSA strain (ATCC 33591). A well-characterized strain of MRSA (ATCC 33591) and Methicillin Sensitive Staphylococcus aureus (MSSA) (ATCC 12600) was prepared from Iranian Biological Resource Center. Briefly, 20 µl of the reaction mixture containing 1.6 µM of each FIB and BIP primer, 0.2 µM of each F3 and B3 primer, 2 µl reaction buffer (10×), 0.8 M of betaine solution, 8 mM of MgSO4, 1.4 mM of deoxy Nucleotide Phosphate (dNTP) mix content of dATP, dCTP, dGTP, 0.52 mM dTTP and 0.88 mM biotin-11-dUTP, 8 units of Bst DNA polymerase, 50 ng of DNA template up to 20 µl dH2O was used. The reaction mixture was incubated at 60 °C for 60 min, followed by the enzyme inactivation at 80°C for 5 min. Negative control (with MSSA template DNA) and blank control (with no template DNA) were included in every reaction set.

Determining the LAMP products by quantum dot (QD) and green viewer (GV): The biotin-labelled LAMP products were aliquot to two tubes (9 µl in each tube), 1 µl streptavidin-coated QD was added to the first tube and 1 µl GV (a florescent dye purchased from Pars Tous Company, Mashhad, Iran) was added to the second tube. Afterwards, UV was brought to the tubes for 45 s in 25°C by the photo-optic system of Rotor-Gene-Q device (QIAgene, Germany). In addition, the LAMP products were tested by 1% agarose gel electrophoresis.

PCR detection of mecA gene: In parallel, PCR targeting mecA gene was performed on 30 MRSA samples have been previously diagnosed by culture methods. PCR was carried out in a 20 µl volume containing 10 µl of 2×-PCR-Mix (Emerald Amp PCR Mix, Takara Bioscience Ltd., Japan), 1 µl of F3 primer (0.2 µM), 1 µl of B3 primer (0.2 µM), 7 µl of deionized water and 50 ng of DNA template. The PCR program was 98°C for 10 s, 50°C for 30 s, 72°C for 1 min and repeated for 30 cycles. Following PCR, 10 µl of each sample was subjected to electrophoresis on 1% agarose gel for 45 min.

Determination of the limit of detection (LoD) in LAMP and PCR: The sensitivity of LAMP and PCR assays was checked by using a serial dilution of MRSA DNA template. To determine LoD in LAMP and PCR assays, one loop of MRSA (ATCC 33591) cultured on tryptic soy agar media (specific media for S. aurous) was mixed with sterile normal saline (equivalent of 1 McFarland by reading the absorbance unit in 625 nm between 0.08-0.13) and serially diluted in 10 tubes with blood from 10−1 to 10−8 concentrations. 50 µl of 1 McFarland MRSA concentration was spiked into 450 µl of blood sample and diluted serially to 9 tubes contained 450 µl of blood. The blood sample used here was obtained from a healthy donor with no infectious diseases. The blood samples were stored at 4°C in K2-EDTA anti coagulated blood tube. Genomic DNA from each dilution was extracted by QIAamp mini kit and used as a DNA template for the LAMP and PCR.

 

Results :

LAMP and PCR detections for mecA gene: All thirty MRSA samples were tested for mecA gene by PCR, conventional LAMP, GV-LAMP and QD-LAMP (Table 1). The GV-LAMP had higher sensitivity than other PCR-based tests, thus provided minimum false-negative predictions. The sensitivity of the performed PCRs, conventional LAMP, GV-LAMP and QD-LAMP on all positive MRSA samples were 93.33, 96.66, 100 and 86.66%, respectively. 

LoD of LAMP assays (conventional LAMP, GV-LAMP and QD-LAMP) and PCR: The LoD for the PCR was 5×10-2 (equivalent of 1.5×107 number of bacteria). The LoD for the conventional LAMP (conventionally detected with gel electrophoresis) was 5×10-3 (equivalent of 1.5×106 number of bacteria) (Figure 3). The LoD for the GV-LAMP was 5×10-4 (equivalent of 1.5×105 number of bacteria) and the LoD for the QD-LAMP was 5×10-5 (equivalent of 1.5×104 number of bacteria) (Figure 4). LoDs obtained from conventional LAMP, GV-LAMP, QD-LAMP, and PCR assays showed that the PCR had the lowest LoD and QD-LAMP had the best LoD among the tests (Table 2).

 

Discussion :

The results of our study showed that QD-LAMP had higher sensitivity for detection of MRSA. In this study, LAMP test was used for the simple and rapid detection of S. aureus directly from septicemia blood samples with no need for complicated devices such as thermocycler and gel documentation system.  LAMP occurred in a single tube under isothermal condition by two pairs of designed primers. While the reactions was done, added GV and QDs to these products contained biotin-11-dUTP which could give the ability to the products to distribute the light after UV radiation. In our study, the LAMP tests determined the better LoD when compared to the PCR. The LoD of the QD-LAMP test was respectively higher than PCR (5×10-5 vs. 5×10-2). In the current study, utilizing biotin-11-dUTP caused higher affinity compared to QDs coated with streptavidin; hence, the LAMP amplicons produced a stronger light emission and thus allowed the reaction to be read in a real-time format.

However, Su et al showed that the 25 μl reactant was found to be the most cost-efficient volume, and the detection limit was determined to be 10 DNA copies and 10 CFU/reaction. High specificity was observed when orfX-LAMP assay was subjected to 116 reference strains. For application, 557 (98.4%, 557/566) and 519 (91.7%, 519/566) tested strains had been detected positive by LAMP and PCR assays 4. Also, Lim et al, showed that both LAMP and PCR assays had 100% specificity and 100% sensitivity, when tested on 30 spiked blood specimens (21 MRSA, eight non-S. aureus and one negative control). Their findings indicated that the LAMP assay was equally specific with a shorter detection time when compared to PCR in the identification of S. aureus 8. In another study, out of 60 blood cultures positive for Gram-positive cocci in clusters, LAMP (via detection of the FemA and MecA genes) showed 100% sensitivity and specificity for identification of MRSA/MSSA. When coagulase negative staphylococci were tested, sensitivity for detection of methicillin resistance was 91.7% and specificity was 100% 7. However, Goldmeyer et al, indicated that the LAMP amplicons could be detected using a disposable detection device. Moreover, the analytical sensitivity of the assay was 50 CFU per reaction, and the clinical sensitivity and specificity were both 100% for S. aureus detection and 100 and 98% for methicillin resistance determination, respectively 31.

In this study, the whole process of GV-LAMP and QD-LAMP tests from the extraction of DNA samples to endpoint detection just needed 2 hr whereas the PCR assay needed 4 to 5 hr from DNA extraction to the visualization of the products using gel electrophoresis system. However, Metwally et al, designed LAMP reaction for MRSA from the blood culture bottles in 120 min (60 min for preparation and 60 min for LAMP reaction), in addition to 50 min to extract DNA 7. On the other hand, Sudhaharan et al, designed LAMP assay using phenotypic tests and conventional PCR for detection of nuc and mecA genes among clinical isolates of Staphylococcus.

In this study, after reaction, a DNA intercalating dye such as picogreen, SYBR green or propidium iodide made better visibility for results and detection was completely finished by naked eye 2. Also, Goldmeyer et al, designed a simple, rapid, and user-friendly procedure to identify S. aureus and determined its methicillin resistance directly from gram-positive cocci in cluster-containing blood culture medium. The samples were diluted and heated prior to amplification of the nuc and mecA genes with isothermal helicase-dependent amplification 31.

 

Conclusion :

In the past decade, LAMP has become the most valuable technology to identify micro-organisms such as bacteria 32,33. LAMP reaction happens in a single tube to amplify the DNA under constant temperature 34. This characteristic of LAMP method in general eliminate the need for thermal cyclers 13,35. These rapid and simple features have the advantage of this method on PCR 36. Therefore, LAMP method has always been considered by clinicians for early diagnosis of infectious diseases and simple screening at the point of care 33,37.

This method can be very useful for low-income countries to diagnose infectious diseases 14,38. Our results using GV-LAMP and QD-LAMP also demonstrated that LAMP in the real-time formats could be done with acceptable LoD for MRSA- positive blood samples particularly from the pediatrics with low quantity; however, we concluded that the QD-LAMP assay was very easy to operate and does not require complex devices when compared to PCR instrument.

 

Acknowledgement :

The authors thank the Central Research Laboratory of Mazandaran University of Medical Sciences for supporting this study. The study was supported by the Chancellor of Research and Technology of Mazandaran University of Medical Sciences according to grant number 2204 in 2015.

 

Conflict of Interest :

The authors report no conflict of interest. The authors alone are responsible for the content and writing of this article.

 


References :
  1. 1.Wang XR, Wu LF,Wang Y, Ma YY, Chen FH, Ou HL. Rapid detection of Staphylococcus aureus by loop-mediated isothermal amplification. Appl Biochem Biotechnol 2015;175(2):882-91.   [PubMed]
  2. 2. Sudhaharan S, Vanjari L, Mamidi N, Ede N, Vemu L. Evaluation of LAMP assay using phenotypic tests and conventional PCR for detection of nuc and mecA genes among clinical isolates of Staphylococcus spp. J Clin Diag Res 2015;9(8):DC06- 9.   [PubMed]
  3. 3. Rahimzadeh G, Gill P, Rezai MS. Characterization of methicillin-resistant Staphylococcus aureus (MRSA) phages from sewage at a tertiary pediatric hospital. Arch Pediatr Infect Dis 2015;5: e39615.   [Abstract]
  4. 4. Su J, Liu X, Cui H, Li Y, Chen D, Li Y, et al. Rapid and simple detection of methicillin-resistance Staphylococcus aureus by orfX loop-mediated isothermal amplification assay. BMC Biotechnol 2014;14:8.   [PubMed]
  5. 5. You R, Gui Z, Xu Z, Shirtliff ME, Yu G, Zhao X, et al. Methicillin-resistance Staphylococcus aureus detection by an improved rapid polymerase chain reaction (PCR) assay. Afr J Microbiol 2012;Res 6:7131-3.
  6. 6. Ghindilis AL, Smith MW, Simon HM, Seoudi IA, Yazvenko NS, Murray IA, et al. Restriction cascade exponential amplification (RCEA) assay with an attomolar detection limit: a novel, highly specific, isothermal alternative to qPCR. Sci Rep 2015;5:7737.   [PubMed]
  7. 7. Metwally L, Gomaa N, Hassan R. Detection of methicillin-resistant Staphylococcus aureus directly by loop-mediated isothermal amplification and direct cefoxitin disk diffusion tests. East Mediterr Health J 2014;20(4):273-9.   [PubMed]
  8. 8. Lim KT, Teh CSJ, Thong KL. Loop-mediated isothermal amplification assay for the rapid detection of Staphylococcus aureus. Biomed Res Int 2013;2013:895816.   [PubMed]
  9. 9. Misawa Y, Yoshida A, Saito R, Yoshida H, Okuzumi K, Ito N, et al. Application of loop-mediated isothermal amplification technique to rapid and direct detection of methicillin-resistant Staphylococcus aureus (MRSA) in blood cultures. J Infect Chemother 2007;13(3):134-40.   [PubMed]
  10. 10. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28(12):E63.   [PubMed]
  11. 11. Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T. Loop-mediated isothermal amplification reaction using a nondenatured template. Cli. Chem 2001;47(9):1742-3.   [PubMed]
  12. 12. Notomi T. [Loop-mediated isothermal amplification]. Nihon Rinsho 2007;65(5):957-61. Japanese.   [PubMed]
  13. 13. Dhama K, Karthik K, Chakraborty S, Tiwari R, Kapoor S, Kumar A, et al. Loop-mediated isothermal amplification of DNA (LAMP): a new diagnostic tool lights the world of diagnosis of animal and human pathogens: a review. Pak J Biol Sci 2014;17(2):151-66.   [PubMed]
  14. 14. Gill P, Ghaemi A. Nucleic acid isothermal amplification technologies - a review. Nucleosides Nucleotides Nucleic Acids 2008;27(3):224-43.   [PubMed]
  15. 15. Song T, Toma C, Nakasone N, Iwanaga M. Sensitive and rapid detection of Shigella and enteroinvasive Escherichia coli by a loop‐mediated isothermal amplification method. FEMS Microbiol Lett 2005;243(1):259-63.   [PubMed]
  16. 16. Horisaka T, Fujita K, Iwata T, Nakadai A, Okatani A.T, Horikita T, et al. Sensitive and specific detection of Yersinia pseudotuberculosis by loop-mediated isothermal amplification. J Clin Microbiol 2004;42(11):5349-52.   [PubMed]
  17. 17. Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M. Loop-mediated isothermal amplification for the rapid detection of Salmonella. FEMS Microbiol Lett 2005;253(1):155-61.   [PubMed]
  18. 18. Yamazaki W, Ishibashi M, Kawahara R, Inoue K. Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Vibrio parahaemolyticus. BMC Microbiol 2008;8:163.   [PubMed]
  19. 19. Chen S, Ge B. Development of a toxR-based loop-mediated isothermal amplification assay for detecting Vibrio parahaemolyticus. BMC Microbiol 2010;10:41.   [PubMed]
  20. 20. EI-Jakee J, Marouf S, Ata NS, Abdel-Rahman EH, El-Moez SIA, Samy AA, et al. Rapid method for detection of Staphylococcus aureus enterotoxins in food. Glob Vet 2013;11:335-41.
  21. 21. Xia Y, Guo XG, Zhou S. Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification. J Thorac Dis 2014;6:1193-9.   [Abstract]
  22. 22. Goto M, Honda E, Ogura A, Nomoto A, Hanaki KI. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 2009;46(2009):167-72.   [PubMed]
  23. 23. Nikbakht H, Gill P, Tabarraei A, Niazi A. Nanomolecular detection of human influenza virus type A using reverse transcription loop-mediated isothermal amplification assisted with rod-shaped gold nanoparticles. RSC Adv 2014;4:13575-80.
  24. 24. Zanoli LM, Spoto G. Isothermal amplification methods for the detection of nucleic acids in microfluidic devices. Biosensors (Basel) 2012;(1)3:18-43.   [PubMed]
  25. 25. Sharafdarkolaei SH, Motovali-Bashi M, Gill P. Fluorescent detection of point mutation via ligase reaction assisted by quantum dots and magnetic nanoparticle-based probes. RSC Adv 2017;7:25665-72.
  26. 26. Yeh HC, Ho YP, Shih IM, Wang TH. Homogeneous point mutation detection by quantum dot-mediated two-color fluorescence coincidence analysis. Nucleic Acids Res 2006;34(5):e35.   [PubMed]
  27. 27. Weinstein MP. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. 11th ed. PA, USA: Clinical and Laboratory Standards Institute; 2018. p.112.
  28. 28. Bauer A, Kirby W, Sherris J.C, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966;45(4):493-6.   [PubMed]
  29. 29. Brown DF, Edwards DI, Hawkey PM, Morrison D, Ridgway GL, Towner KJ, et al. Guidelines for the laboratory diagnosis and susceptibility testing of methicillin-resistant Staphylococcus aureus (MRSA). J Antimicrob Chemother 2005;56(6):1000-18.   [PubMed]
  30. 30. QIAamp DNA Mini Blood Mini Handbook. Qiagen. 2012.
  31. 31. Goldmeyer J, Li H, McCormac M, Cook S, Stratton C, Lemieux B, et al. Identification of Staphylococcus aureus and determination of methicillin resistance directly from positive blood cultures by isothermal amplification and a disposable detection device. J Clin Microbiol 2008;46(4):1534-6.   [PubMed]
  32. 32. Lucchi NW, Demas A, Narayanan J, Sumari D, Kabanywanyi A, Kachur SP, et al. Real-time fluorescence loop mediated isothermal amplification for the diagnosis of malaria. PLoS One 2010;5(10):e13733.   [PubMed]
  33. 33. Mori Y, Notomi T. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J Infect Chemother 2009;15(2):62-9.   [PubMed]
  34. 34. Zhao XH, Li Y, Park MS, Wang J, Zhang Y, He X, et al. Loop-mediated isothermal amplification assay targeting the femA gene for rapid detection of Staphylococcus aureus from clinical and food samples. J Microbiol Biotechnol 2013;23(2):246-50.   [PubMed]
  35. 35. Nie K, Zhao X, Ding X, Li X, Zou S, Guo J, et al. Visual detection of human infection with influenza A (H7N9) virus by subtype‐specific reverse transcription loop‐mediated isothermal amplification with hydroxynaphthol blue dye. Clin Microbiol Infect 2013;19(8):E372-5.   [PubMed]
  36. 36. Sowmya N, Thakur M, Manonmani H. Rapid and simple DNA extraction method for the detection of enterotoxigenic Staphylococcus aureus directly from food samples: comparison of PCR and LAMP methods. J Appl Microbiol 2012;113(1):106-13.   [PubMed]
  37. 37. Xu H, Zhang L, Shen G, Feng C, Wang X, Yan J, et al. Establishment of a novel one-step reverse transcription loop-mediated isothermal amplification assay for rapid identification of RNA from the severe fever with thrombocytopenia syndrome virus. J Virol Methods 2013;194(1-2):21-5.   [PubMed]
  38. 38. Soleimani M, Shams S, Majidzadeh-A K. Developing a real‐time quantitative loop‐mediated isothermal amplification assay as a rapid and accurate method for detection of Brucellosis. J Appl Microbiol 2013;115(3):828-34.   [PubMed]