Cloning and Expression of B. mellitensis bp26 Gene in Lactococcus lactis as a Food Grade Vaccine


PDF - Export to EndNote - PubMed Central XML format - PubMed Central XML format

PMID: 31380001 (PubMed) - PMCID: PMC6626509 - View online: PubReader
Volume 11, Issue 3, July-September , Page 264 to 267
Saturday, January 13, 2018 :Received , Sunday, April 8, 2018 :Accepted


  • - Department of Microbiology, Islamic Azad University, Arak Branch, Arak, Iran
  • Corresponding author Razi Vaccine and Serum Research Institute, Arak, Iran, Tel: +98 86 33544702, Fax: +98 86 33544704, E-mail: hosseinida@yahoo.com
    - Razi Vaccine and Serum Research Institute, Agricultural Research, Education & Extension Organization, Arak, Iran

  • - Razi Vaccine and Serum Research Institute, Agricultural Research, Education & Extension Organization, Karaj, Iran

Abstract:

Background: Brucellosis is still an important health problem in under developing countries and researches for finding efficient vaccine are going on. Brucella melitensis (B. mellitensis) bp26 gene is a good candidate for brucellosis vaccine and investigations showed that Lactococcus lactis (L. lactis) with several positive characteristic are attractive for protein expression as a live delivery vectors. These fast growing bacteria need no aeration, are easy to handle, have no exotoxin, endotoxin and protease, so the cost of culturing is inexpensive.
Methods: B. mellitensis bp26 gene was cloned in food grade pNZ 8149 vector and expressed in L. lactis NZ 3900.
Results: Results showed that we can produce a food-grade recombinant L. lactis producing the B. melitensis BP26 protein. 
Conclusion: In this study, for Future evaluation about ability of L. lactis as a live delivery vector, a food-grade recombinant L. lactis producing the B. melitensis BP26 protein was produced. 


 

 


Introduction :

Brucellosis is zoonotic diseases which made health and economic problem in many countries 1. In industrialized nations because of routine screening of domestic livestock and animal vaccination brucellosis in humans and livestock are relatively uncommon. Up to now no human vaccines are available, and current animal vaccines are both virulent in humans and lack clinical efficacy 2. Therefore, an efficient, economical and easily managed vaccine needs to be developed. 
Researchers revealed that Brucella melitensis (B. melitensis) bp26 gene is a good immunogen  and can be candidate for Brucella spp vaccine 3. This gene encoding the 28 kDa periplasmic protein is named BP26, CP28 or Omp28 and is a target molecule to detect anti-Brucella antibodies 4,5. To date, Lactococcus lactis (L. lactis) is attractive live delivery vector through mucosal routes for delivering bioactive proteins. L. lactis enters through M cells and multiplied within phagocytic cells so releasing and spreading in deeper layer was occurred. Therefore induction of immune responses against L. lactis antigens was Getting Started 6-10. PNZ8149 was used as the broad host range vector. This vector produces a cytoplasmic protein and to prevent protein removal by digestive enzymes or by other factors in the digestive tract, this protein was not designed to be secreted or attached to the cell surface of bacteria. Therefore, after entering of this recombinant bacterium through the M cells and up taking via phagocytic cells, the probability of induction the immune system, through BP26 protein, is higher 10.
In this study for first time, B. mellitensis bp26 gene was cloned into the PNZ 8149 vector and expressed in L. lactis NZ 3900 for used as a research experimental tool to find a good vaccine candidate.

 


Materials and Methods :

Bacterial strains and growth conditions: Any bacterial strains and plasmids used in this study are showed in table 1. All L. lactis strains were grown at 30oC on M17 media (Merck, Germany) containing 0.5% glucose (M17-glu) or lactose (M17-lac). All Escherichia coli (E. coli) DH5α strain were grown at 37oC on Luria-Bertani (LB) medium (Merck, Germany) containing 50 μg/ml Ampicillin or 50 μg/ml kanamycin.
Amplification of bp26 gene: To amplify the bp26 gene, one pair of PCR primers was designed based on sequences published in Gene Bank (accession No. JF918758.1), and the restriction endonuclease sites of XbaI and SphI were added to both ends of the modified bp26 protein gene e based on the structure of PNZ8149 (forward: GCATGCA TGAACACTCGTGC and reverse: TCTAGATTACTTGATTTCAAAAACGAC). Template DNA (pET28a+bp26) preserved by Our lab 3. The PCR was performed initial denaturation at 95oC for 2 min, followed by 34 cycles of 95oC for 1 min, 58oC for 1 min, and 72oC for 1 min. with Extra polymerization in 72oC for 30 min. The PCR product consisting 753 bp was checked using agarose gel electrophoresis and then purified using a Fermentas Silica Bead DNA Gel Extraction Kit.
Cloning and transformation: The PCR product was cloned in to pTZ57R/T vector and transformed in E. coli DH5α competent cells. The recombinant pTZ57R/T plasmid was extracted and digested with two restriction enzymes (SphI /NEB Bio lab and XbaI/Fermentas Digestion Enzyme). At the same time the pNZ8149 plasmid was digested with both SphI and XbaI and purified. The purified desire was inserted into the pNZ8149. Competent L. lactis NZ39000 cells were then electro-transformed with the recombinant plasmids (Gene e-Pulser; Bio-Rad, Hercules, CA, USA) and cultured on Elliker agar-lac bromocresol purple and incubated at 30oC for 48 hr. Transformants harboring the recombinant plasmids were verified through enzymatic digestion and PCR.
Expression of recombinant protein: Expression performed according to MoBiTec NICE_Expression_System and analyzed on 10% SDS- PAGE. To confirm the accuracy of the SDS-Page and protein expression, Western Blot was performed with Nitrocellulose Membrane (Sigma) and using the Trans-Blot SD cell (BIO-RAD). After blocking with TBST (tris-buffered saline, 0.05% Tween-20) buffer containing 5% skimmed milk at 4°C overnight, the membranes were incubated with a mouse IgG monoclonal antibody, anti- OMP28, (MyBioSource, Inc, USA) at a dilution 1:500 in phosphate-buffered saline (PBS) at a 37°C for 60 min. Then, the blots were washed and incubated with 1:2000 dilution of HRP-conjugated rabbit anti-mouse IgG (MyBioSource, Inc, USA) for 60 min. Binding was visualized using diaminobenzidine (Merck), according to the manufacturer's instruction.

 


Results :

PCR screening: Results showed that the expected DNA band of the bp26 gene had been amplified; the PCR product was approximately 753 bp in length plus the 12 bp restriction sites (Figure 1).
Digestion screening: Double-digestion confirms the size of bp26 gene (Figure 2).
Induced expression of the recombinant L. lactis: Results of bp26 gene expression on SDS-PAGE; as it is evident in the figure, with increasing Nisin (1 ng/ml) addition time, the amount of protein expression also increases. Protein production increase with Nisin and in 5th hr the high level of protein production was seen. Results indicated that the molecular weight of the expressed recombinant protein was approximately 28 kDa (Figure 4).
Western blot results showed that the produced protein was the B. melitensis omp28 (Figure 5). The result show that the binding of BP26 protein and its antibody occurred.

 


Discussion :

Brucellosis is a worldwide zoonotic disease, which remain an important public health concern and causes economic losses in endemic areas 11,12. Vaccination is the most possible way to reduce the transmission in domestic animal herds and humans. The infectious cycles of most pathogenic micro-organisms initiate from mucosal surfaces. So, if colonization and invasion of infectious agents stopped in this stage, the infection does not happen. For this purpose, a vaccine must be made to stimulate mucosal and cellular immunity 13-15. Today, investigations showed that using Lactic Acid Bacteria (LAB) as a live delivery vectors for antigens can induce mucosal immunity and one of the most important candidates to produce mucosal vaccines. In this investigation, we used L. lactis 3900 as a gene delivery vehicle. Despite the fact that L. lactis is a non-commensal and non-colonizing bacterium at the level of the gastrointestinal tract, it can be easily taken up by M cells, and exhibits adjuvant/immune potentiating activity 16,17. As Brucella infections involve mainly bacterial entry through the mucosal routes, the development of successful approaches for oral vaccination could radically alter the current scene of brucellosis 18,19. Most published studies have evaluated the use of live vectors expressing Brucella antigens for vaccine delivery at the mucosal gut. At present, several recombinant proteins of Brucella have been evaluated as oral vaccine with L. lactis and sufficient evidence showed that they can induce protective immunity in mice 19-23. For example, in 2002, Luciana A. Ribeiro et al expressed Brucella abortus L7/L12 gene in L. lactis, under the nisin-inducible promoter 22. In another work, Daniela S. Pontes et al in 2003, revealed that a recombinant Lactococcus lactis strain producing L7/L12 under the control of nisin inducible promoter when orally administered to BALB/c mice, they could induced local humoral immune response and detected significant levels of anti-L7/L12 specific IgA in feces 21.
In 2012 DarwinSáez et al, transformed Brucella abortus (B. abortus) Cu-Zn Superoxide dismutase (SOD) in L. lactis and revealed that orally vaccinated mice protected against challenge with the virulent B. abortus 2308 strain 19.

 


Conclusion :

According to the investigations which mentioned above and considering that B. melitensis BP26 is a good immunogenic protein 24, in this study, we successfully constructed a food-grade recombinant L. lactis producing the B. melitensis BP26  protein for future researches about induction of immune response by this protein.

 


Acknowledgement :

The authors thank Dr. Behrozikhah, Razi Vccine and Serum Research Institute, Agricultural Research, Education & Extension Organization, Karaj, Iran and Dr. Tavangar, Razi Vaccine and Serum Research Institute, Agricultural Research, Education & Extension Organization, Karaj, Iran for their constant support and guidance.

 



<p>Figure 1. Colony PCR from random selected colonies on 1% agarose gel: Lane 1; Fermentas 1 <em>Kb</em> DNA Ladder, Lane 3, 4, 5, 6 and 7; ne-gative colonies, Lane 2; positive colonies.</p>

Figure 1. Colony PCR from random selected colonies on 1% agarose gel: Lane 1; Fermentas 1 Kb DNA Ladder, Lane 3, 4, 5, 6 and 7; ne-gative colonies, Lane 2; positive colonies.





<p>Figure 2. Double-digestion on 1% agarose gel: Lane 1; pNZ 8149, Lane 2; Fermentas 1 <em>Kb</em> DNA Ladder, Lane 3; pNZ 8149+ bp26 double-digestion.</p>

Figure 2. Double-digestion on 1% agarose gel: Lane 1; pNZ 8149, Lane 2; Fermentas 1 Kb DNA Ladder, Lane 3; pNZ 8149+ bp26 double-digestion.





<p>Figure 3. <em>bp26</em> gene&nbsp; expression on SDS-PAGE: Lane 1; <em>L. lactis</em> with pNZ 8149 vector, Lane 2; <em>L. lactis</em> 3900, Lane 3; Fermentas protein Ladder, Lane 4; transformed <em>L. lactis</em> with recombinant pNZ 8149+bp26 vector before adding Nisin, Lane 5; transformed <em>L. lactis</em> with recombinant pNZ 8149+bp26 vector 1 <em>hr</em> after adding Nisin, Lane 6; transformed <em>L. lactis</em> with recombinant pNZ 8149+bp26 vector 3 <em>hr</em> after adding Nisin, Lane 7; transformed <em>L. lactis</em> with recombinant pNZ 8149+bp26 vector 5 <em>hr</em> after adding Nisin.</p>

Figure 3. bp26 gene  expression on SDS-PAGE: Lane 1; L. lactis with pNZ 8149 vector, Lane 2; L. lactis 3900, Lane 3; Fermentas protein Ladder, Lane 4; transformed L. lactis with recombinant pNZ 8149+bp26 vector before adding Nisin, Lane 5; transformed L. lactis with recombinant pNZ 8149+bp26 vector 1 hr after adding Nisin, Lane 6; transformed L. lactis with recombinant pNZ 8149+bp26 vector 3 hr after adding Nisin, Lane 7; transformed L. lactis with recombinant pNZ 8149+bp26 vector 5 hr after adding Nisin.





<p>Figure 4. BP26 production was approved by western blot analysis. Lane 1; BP26 before adding nisin, Lane 2; BP26 production 1 <em>hr</em> after adding nisin, Lane 3; BP26 production 3 <em>hr</em> after adding nisin, Lane 4; BP26 production 5 <em>hr</em> after adding nisin.</p>

Figure 4. BP26 production was approved by western blot analysis. Lane 1; BP26 before adding nisin, Lane 2; BP26 production 1 hr after adding nisin, Lane 3; BP26 production 3 hr after adding nisin, Lane 4; BP26 production 5 hr after adding nisin.





<p>Table 1. Bacteria strains and plasmids used in this study</p>

Table 1. Bacteria strains and plasmids used in this study






References :
  1. Avila-Calderón ED, Lopez-Merino A, Sriranganathan N, Boyle SM, Contreras-Rodríguez A. A history of the development of brucella vaccines. BioMed Res Int 2013;2013:743509.   [PubMed]
  2. Acharya KP, Kaphle K, Shrestha K, Bastuji BG, Smits HL. Review of brucellosis in Nepal. Int J Veterinary Sci Med 2016;4(2):54-62.
  3. Basiri H, Akbari N, Azizpour M, Hossein SD, Behrozikhah AM, Eskandari S. Amplification, cloning and expression of Brucella melitensis bp26 gene (OMP28) isolated from Markazi province (Iran) and purification of Bp26 protein. Archives Razi Institute 2013;68(2):111-116.
  4. Chaudhuri P, Prasad R, Kumar V, Gangaplara A. Recombinant OMP28 antigen-based indirect ELISA for serodiagnosis of bovine brucellosis. Mol Cell Probes 2010;24(3):142-145.   [PubMed]
  5. Gupta VK, Radhakrishnan G, Harms J, Splitter G. Invasive Escherichia coli vaccines expressing Brucella melitensis outer membrane proteins 31 or 16 or periplasmic protein BP26 confer protection in mice challenged with B. melitensis. Vaccine 2012;30(27):4017-4022.   [PubMed]
  6. Pontes DS, de Azevedo MS, Chatel JM, Langella P, Azevedo V, Miyoshi A. Lactococcus lactis as a live vector: heterologous protein production and DNA delivery systems. Protein Expr Purif 2011;79(2):165-175.   [PubMed]
  7. Nouaille S, Ribeiro LA, Miyoshi A, Pontes D, Le Loir Y, Oliveira SC, et al. Heterologous protein production and delivery systems for Lactococcus lactis. Genet Mol Res 2003;2(1):102-111.   [PubMed]
  8. Scavone P, Miyoshi A, Rial A, Chabalgoity A, Langella P, Azevedo V, et al. Intranasal immunisation with recombinant Lactococcus lactis displaying either anchored or secreted forms of Proteus mirabilis MrpA fimbrial protein confers specific immune response and induces a significant reduction of kidney bacterial colonisation in mice. Microbes Infect 2007;9(7):821-828.   [PubMed]
  9. Zhang Q, Zhong J, Huan L. Expression of hepatitis B virus surface antigen determinants in Lactococcus lactis for oral vaccination. Microbiol Res 2011;166(2):111-120.   [PubMed]
  10. Azizpour M, Hosseini SD, Jafari P, Akbary N. Lactococcus lactis: A new strategy for vaccination. Avicenna J Med Biotechnol 2017;9(4):163-168.   [PubMed]
  11. Carvalho Neta AV, Mol JP, Xavier MN, Paixão TA, Lage AP, Santos RL. Pathogenesis of bovine brucellosis. Vet J 2010;184(2):146-155.   [PubMed]
  12. Hotez PJ, Savioli L, Fenwick A. Neglected tropical diseases of the Middle East and North Africa: review of their prevalence, distribution, and opportunities for control. PLoS Negl Trop Dis 2012;6(2):e1475.   [PubMed]
  13. D’Souza R, Pandeya DR, Hong ST. Review: Lactococcus lactis: an efficient gram positive cell factory for the production and secretion of recombinant protein. Biomed Res 2012;23(1).
  14. Bermúdez-Humarán LG. Lactococcus lactis as a live vector for mucosal delivery of therapeutic proteins. Hum Vaccin 2009;5(4):264-267.   [PubMed]
  15. Wells JM. Immunomodulatory mechanisms of lactobacilli. Microb Cell Fact 2011;10(1):S17.
  16. Kumar GB, Ganapathi TR, Bapat VA. Production of hepatitis B surface antigen in recombinant plant systems: an update. Biotechnol Prog 2007;23(3):532-539.   [PubMed]
  17. Chen H. Recent advances in mucosal vaccine development. J Controlled Release (JCR) 2000;67(2-3):117-128.
  18. Pasquevich KA, Ibañez AE, Coria LM, García Samartino C, Estein SM, Zwerdling A, et al. An oral vaccine based on U-Omp19 induces protection against B. abortus mucosal challenge by inducing an adaptive IL-17 immune response in mice. PLoS One 2011;6(1):e16203.   [PubMed]
  19. Sáez D, Fernández P, Rivera A, Andrews E, Oñate A. Oral immunization of mice with recombinant Lactococcus lactis expressing Cu, Zn superoxide dismutase of Brucella abortus triggers protective immunity. Vaccine 2012;30(7):1283-1290.   [PubMed]
  20. Stabel TJ, Mayfield JE, Tabatabai LB, Wannemuehler MJ. Oral immunization of mice with attenuated Salmonella typhimurium containing a recombinant plasmid which codes for production of a 31-kilodalton protein of Brucella abortus. Infect Immun 1990;58(7):2048-2055.   [PubMed]
  21. Pontes DS, Dorella FA, Ribeiro LA, Miyoshi A, Le Loir Y, Gruss A, et al. Induction of partial protection in mice after oral administration of Lactococcus lactis producing Brucella abortus L7/L12 antigen. J Drug Target 2003;11(8-10):489-493.   [PubMed]
  22. Ribeiro LA, Azevedo V, Le Loir Y, Oliveira SC, Dieye Y, Piard JC, et al. Production and targeting of the Brucella abortus antigen L7/L12 in Lactococcus lactis: a first step towards food-grade live vaccines against brucellosis. Appl Environ Microbiol 2002;68(2):910-916.   [PubMed]
  23. Miyoshi A, Bermúdez-Humarán LG, Ribeiro LA, Le Loir Y, Oliveira SC, Langella P, et al. Heterologous expression of Brucella abortus GroEL heat-shock protein in Lactococcus lactis. Microb Cell Fact 2006;5(1):14.   [PubMed]
  24. Thavaselvam D, Kumar A, Tiwari S, mMishra M, Prakash A. Cloning and expression of the immunoreactive Brucella melitensis 28 kDa outer-membrane protein (Omp28) encoding gene and evaluation of the potential of Omp28 for clinical diagnosis of brucellosis. J Med Microbiol 2010;59(4):421-428.   [PubMed]